Stem-loop sequence mml-mir-320b

AccessionMI0020860 (change log)
DescriptionMacaca mulatta miR-320b stem-loop
Gene family MIPF0000163; mir-320
Literature search

3 open access papers mention mml-mir-320b
(11 sentences)

Stem-loop
   guuauuuuuagucuucuaccuaagaau   --g  u   ag        uu         -    a 
5'                            ucu   uc cuu  gcuuucuc  cccaguuuu ccca a
                              |||   || |||  ||||||||  ||||||||| ||||  
3'                            aga   ag gaa  cgggagag  gggucgaaa gggu g
   --------------------aaaaaaa   aaa  -   aa        uu         a    u 
Get sequence
Deep sequencing
91579 reads, 367 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 142175725-142175834 [+]
intergenic
Database links

Mature sequence mml-miR-320b

Accession MIMAT0024312
Sequence

71 - 

aaaagcuggguugagagggcaa

 - 92

Get sequence
Deep sequencing91572 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).