Stem-loop sequence ggo-mir-454

AccessionMI0020828 (change log)
DescriptionGorilla gorilla miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   aaaaauucuguuuaauca     uc            ---         ----   --u     g 
5'                   ccaga  cuagaacccuau   caauauugu    cuc   gcugu u
                     |||||  ||||||||||||   |||||||||    |||   |||||  
3'                   gguuu  gguuuugggaua   guuauaacg    gag   ugaua a
   -----------caagaaa     gu            uuc         ugau   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr5: 24211422-24211533 [+]
sense
ENSGGOT00000013052 ; ENSG00000182628-201; intron 1
ENSGGOT00000035266 ; ggo-mir-454-201; exon 1
Database links

Mature sequence ggo-miR-454

Accession MIMAT0024280
Sequence

71 - 

uagugcaauauugcuuauaggguu

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).