Stem-loop sequence ggo-mir-320b

AccessionMI0020763 (change log)
DescriptionGorilla gorilla miR-320b stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   auuuuuugucuucuaccuaagaauuuugucucuuag        uu     -a       a 
5'                                     gcuuucuc  cccag  uuuccca a
                                       ||||||||  |||||  |||||||  
3'                                     cgggagag  ggguc  agagggu g
   ---------------cuuaagaaaaaaaaaggaaaa        uu     ga       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 204269969-204270076 [-]
sense
ENSGGOT00000039923 ; ggo-mir-320b-201; exon 1
ENSGGOT00000041157 ; NVL-201; intron 18
Database links

Mature sequence ggo-miR-320b

Accession MIMAT0024216
Sequence

68 - 

agaagcuggguugagagggcaa

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).