Stem-loop sequence ggo-mir-320a

AccessionMI0020627 (change log)
DescriptionGorilla gorilla miR-320a stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   gccacaguauuuauuaggcggcgcuucgcuccccuc         uu       c      g 
5'                                     cgccuucuc  cccgguu uucccg a
                                       |||||||||  ||||||| ||||||  
3'                                     gcgggagag  gggucga aagggc g
   ---------------uggucaauggaguaggaaaaa         uu       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr8: 21368198-21368308 [-]
intergenic
Database links

Mature sequence ggo-miR-320a

Accession MIMAT0024080
Sequence

70 - 

aaaagcuggguugagagggcga

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).