Stem-loop sequence ptr-mir-449c

AccessionMI0020618 (change log)
DescriptionPan troglodytes miR-449c stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   -------------aaa   --g       u   gu   c      uu               u 
5'                 gcu   ggaugug cag  agg agugua  gcuagcggcuguuaa a
                   |||   ||||||| |||  ||| ||||||  ||||||||||||||| a
3'                 cga   cuuacgu guc  ucc ucacgu  ugaucguugacaauu u
   aaagaaaccccccgca   aga       u   uc   -      --               u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr5: 59472899-59473009 [+]
sense
ENSPTRT00000031293 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from ptr-mir-449c
ptr-mir-449cchr5: 59472899-59473009 [+]
ptr-mir-449bchr5: 59474515-59474610 [+]
ptr-mir-449achr5: 59474635-59474724 [+]
Database links

Mature sequence ptr-miR-449c

Accession MIMAT0024071
Sequence

21 - 

aggcaguguauugcuagcggcugu

 - 44

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).