Stem-loop sequence cgr-mir-320a

AccessionMI0020491 (change log)
DescriptionCricetulus griseus miR-320a stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   gcgccucgcuacccuc         uu       c      g 
5'                 cgccuucuc  cccgguu uucccg a
                   |||||||||  ||||||| ||||||  
3'                 gcgggagag  gggucga aagggc g
   ------gaaaaaaaaa         uu       a      u 
Get sequence
Deep sequencing
240954 reads, 2.45e+03 reads per million, 6 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000034.1: 1890160-1890239 [-]
intergenic
Database links

Mature sequence cgr-miR-320a

Accession MIMAT0023906
Sequence

50 - 

aaaagcuggguugagagggcga

 - 71

Get sequence
Deep sequencing218408 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).