Stem-loop sequence stu-MIR6027

AccessionMI0020259 (change log)
DescriptionSolanum tuberosum miR6027 stem-loop
Gene family MIPF0001424; MIR6027
Literature search

2 open access papers mention stu-MIR6027
(5 sentences)

Stem-loop
   -uu     -    u                 ac       a   u      aau     auaugugaag    uuggag       
5'    ucaua auuu acaugauuauggguagc  aaggauu aug gaaaca   aagug          aaca      aauuca 
      ||||| |||| |||||||||||||||||  ||||||| ||| ||||||   |||||          ||||      ||||| a
3'    agugu uaag uguacuaauaccuaucg  uuccuaa ugc cuuugu   uucac          uugu      uugaga 
   uuc     g    u                 gc       g   u      -gu     aaaagaagga    ---uga       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137798.1: 3105798-3105962 [-]
intergenic
Database links

Mature sequence stu-miR6027

Accession MIMAT0023612
Sequence

124 - 

ugaauccuucggcuauccauaa

 - 145

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).