Stem-loop sequence stu-MIR6023

AccessionMI0020239 (change log)
DescriptionSolanum tuberosum miR6023 stem-loop
Gene family MIPF0001603; MIR6023
Literature search

1 open access papers mention stu-MIR6023
(1 sentences)

Stem-loop
   --a   g       u a             aag                    u  ca                 a   ----    g    cuuuuggacaauaauuucugaucaaagca 
5'    gca uaaucuc g ucauauuccauga   uguuuuuggauaagauuuuu ac  uaguaaucacaaauacu gau    gacc ugcu                             u
      ||| ||||||| | |||||||||||||   |||||||||||||||||||| ||  ||||||||||||||||| |||    |||| ||||                              
3'    ugu guuagag c aguauaagguacu   acagaaaccuauucuaagga ug  aucauuaguguuuguga cua    cugg augg                             u
   auc   g       c g             -ga                    c  ac                 g   cucc    -    cauucguaagagaacuuaaaaucuucccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137902.1: 575666-575901 [+]
intergenic
Database links

Mature sequence stu-miR6023

Accession MIMAT0023591
Sequence

21 - 

uuccaugaaaguguuuuuggau

 - 42

Get sequence
Evidence not experimental

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).