Stem-loop sequence ath-MIR5996

AccessionMI0020190 (change log)
DescriptionArabidopsis thaliana miR5996 stem-loop
Stem-loop
   --  a                                  c            ---c      gu 
5'   gu cuaauuuuucgagcacaugacauccagauagaag uuuguuaaacgu    aucaaa  c
     || |||||||||||||||||||||||||||||||||| ||||||||||||    ||||||  a
3'   ca gauugagaagcucguguacuguagguuuaucuuc aaacaauuugca    ugguuu  a
   au  a                                  -            aaua      ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 7882765-7882889 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5996
ath-MIR3932bchr4: 7890570-7890719 [-]
ath-MIR841achr4: 7885251-7885462 [-]
ath-MIR5996chr4: 7882765-7882889 [-]
ath-MIR397bchr4: 7878652-7878760 [-]
ath-MIR857chr4: 7878185-7878561 [-]
Database links

Mature sequence ath-miR5996

Accession MIMAT0023519
Sequence

21 - 

ugacauccagauagaagcuuug

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1