Stem-loop sequence hco-mir-84b

AccessionMI0020176 (change log)
DescriptionHaemonchus contortus miR-84b stem-loop
Literature search

1 open access papers mention hco-mir-84b
(1 sentences)

Stem-loop
   ggg    uaau  -     u    -ca    ua  aca      u   -   u 
5'    uguc    ga gguag uaag   cagg  cu   uuaagc gua aau a
      ||||    || ||||| ||||   ||||  ||   |||||| ||| |||  
3'    acgg    cu ccauu auuc   gucc  ga   aguucg cau uua a
   --g    uuau  g     c    uug    uc  -ag      -   g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-84b

Accession MIMAT0023507
Sequence

11 - 

ugagguaguuaagcacaggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).