Stem-loop sequence hco-mir-72

AccessionMI0020167 (change log)
DescriptionHaemonchus contortus miR-72 stem-loop
Gene family MIPF0000277; mir-72
Literature search

1 open access papers mention hco-mir-72
(2 sentences)

Stem-loop
   ---------------------       -  -----aa   aag    u           ---  u 
5'                      guguuga gc       ggc   augu ggcauagcuga   ac g
                        ||||||| ||       |||   |||| |||||||||||   ||  
3'                      cacgacu cg       ccg   uaca ucguaucgacu   ug c
   cuagucaucccuuucuuucuc       a  gcacgca   gag    -           cuu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-72

Accession MIMAT0023498
Sequence

11 - 

aggcaagauguuggcauagcuga

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).