Stem-loop sequence hco-mir-5983

AccessionMI0020161 (change log)
DescriptionHaemonchus contortus miR-5983 stem-loop
Literature search

1 open access papers mention hco-mir-5983
(1 sentences)

Stem-loop
   ----c   --u    u   -    ag   ga     u     c        a u 
5'      ucg   uucg ggc gugc  ugc  gucua cgugu ucaaagcg g a
        |||   |||| ||| ||||  |||  ||||| ||||| |||||||| | u
3'      ggu   gagc ccg caug  acg  cggau guaca gguuucgu c u
   cugaa   uau    -   a    --   gc     u     c        c a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-5983

Accession MIMAT0023493
Sequence

57 - 

uuuggcacauguuaggccggca

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).