Stem-loop sequence hco-mir-250

AccessionMI0020006 (change log)
DescriptionHaemonchus contortus miR-250 stem-loop
Literature search

1 open access papers mention hco-mir-250
(1 sentences)

Stem-loop
   ----ccuacaguu   ug  g     c         c  c     ccg     u 
5'              ggc  uc cccga cggcaguug cu gugau   ugauc g
                |||  || ||||| ||||||||| || |||||   |||||  
3'              ccg  ag gggcu gucgucaac ga cacua   gcuag u
   aagacccagcuug   ua  a     c         c  -     --a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-250

Accession MIMAT0023330
Sequence

56 - 

ucgaaucacagccaacugcugcu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).