Stem-loop sequence osa-MIR5829

AccessionMI0019848 (change log)
DescriptionOryza sativa miR5829 stem-loop
Stem-loop
         aauua     ac      -    -    -aaug     g  u uucuucaacaaugucaauaggaugugcauagguagacacaucauucaauc 
5' gagagc     ucagg  caguag gcga uggu     uguca ag c                                                  c
   ||||||     |||||  |||||| |||| ||||     ||||| || |                                                   
3' uucucg     agucc  gucauu ugcu accg     acggu uc g                                                  u
         aaaag     --      a    u    agaga     a  u aucguuuguacgacgcuguaacuauuguuuagaccaucaucacugguacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 20149367-20149561 [+]
intergenic
Database links

Mature sequence osa-miR5829

Accession MIMAT0023303
Sequence

11 - 

aucaggaccaguaggcgaugguaa

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).