Stem-loop sequence osa-MIR5823

AccessionMI0019841 (change log)
DescriptionOryza sativa miR5823 stem-loop
Stem-loop
   u     a  u  u    c           g    ug     gcuauaaau     u 
5'  guuug au gg gggg uuaggcuuaau ccuu  gaugg         ggaau a
    ||||| || || |||| ||||||||||| ||||  |||||         |||||  
3'  caaac ua cc ucuc aaucuggguua ggaa  cuauc         ccuug a
   a     c  u  u    u           a    gu     -------ac     a 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 21506677-21506783 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5823
osa-MIR2923Chr11: 21507096-21507270 [+]
osa-MIR5823Chr11: 21506677-21506783 [-]
Database links

Mature sequence osa-miR5823

Accession MIMAT0023296
Sequence

74 - 

aaggaauugggucuaaucucuucc

 - 97

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).