Stem-loop sequence osa-MIR5816

AccessionMI0019833 (change log)
DescriptionOryza sativa miR5816 stem-loop
Stem-loop
       g        gua g     c      aaauguaggagcguauauaggaaguuuaauagacuuuua 
5' ucua gaguguuu   g agcgc acguga                                       g
   |||| ||||||||   | ||||| ||||||                                       u
3' agau uuuacgaa   u uugcg ugcacu                                       a
       g        -aa g     a      gagaguuuauuuaaucucuuuaggaucuuuagauaauau 
Get sequence
Deep sequencing
167 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 11583948-11584087 [-]
intergenic
Database links

Mature sequence osa-miR5816

Accession MIMAT0023288
Sequence

3 - 

uaggaguguuuguaggagcgccac

 - 26

Get sequence
Deep sequencing88 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).