Stem-loop sequence osa-MIR5810

AccessionMI0019827 (change log)
DescriptionOryza sativa miR5810 stem-loop
Literature search

1 open access papers mention osa-MIR5810
(1 sentences)

Stem-loop
   g  cu           uu  u   c             ag  a   --u  au   --     auag 
5'  ug  ucauaaaugcu  uc cca uuaggguuccguu  ca ccc   cc  uaa  guacu    g
    ||  |||||||||||  || ||| |||||||||||||  || |||   ||  |||  |||||    a
3'  ac  gguauuuacgg  ag ggu aaucccaaggcag  gu ggg   gg  auu  cguga    u
   -  ag           -u  c   -             --  a   ugu  cu   ua     caag 
Get sequence
Deep sequencing
301 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 7333292-7333419 [-]
intergenic
Database links

Mature sequence osa-miR5810

Accession MIMAT0023282
Sequence

95 - 

acggaacccuaauggcgauggcau

 - 118

Get sequence
Deep sequencing277 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).