Stem-loop sequence osa-MIR5800

Accession

MI0019814 (change log)

Description

Oryza sativa miR5800 stem-loop

Literature search

3 open access papers mention osa-MIR5800
(4 sentences)

Stem-loop

        gaua  -a     ua    ugagag   uca      -c    u 
5' agcag    uc  auagc  ggau      gca   ggagag  accu c
   |||||    ||  |||||  ||||      |||   ||||||  |||| a
3' ucguc    ag  uaucg  ccua      cgu   ccuuuc  uggg a
        ggca  gc     gc    ------   cua      aa    c 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr11: 24921149-24921241 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0019814

Mature sequence osa-miR5800

• Accession: MIMAT0023269
• Sequence: 72 - cccggcuaucggaacggcugc - 92
• Evidence: experimental; Illumina [1]

References

1. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).