Stem-loop sequence osa-MIR5799

AccessionMI0019813 (change log)
DescriptionOryza sativa miR5799 stem-loop
Literature search

2 open access papers mention osa-MIR5799
(7 sentences)

Stem-loop
   uu       uaa  cg    a c          ca    cag  -    ----   g      u 
5'   uuugaaa   ga  aaua u aaacguugga  uaaa   ug uaaa    auu uugucu u
     |||||||   ||  |||| | ||||||||||  ||||   || ||||    ||| |||||| c
3'   agauuuu   cu  uuau a uuugcaauuu  auuu   ac auuu    ugg ggcagg u
   uu       -ca  au    c a          ag    -ua  u    auga   g      a 
Get sequence
Deep sequencing
907 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 10732163-10732286 [+]
intergenic
Database links

Mature sequence osa-miR5799

Accession MIMAT0023268
Sequence

11 - 

aagacgaauaaucaaacguuggac

 - 34

Get sequence
Deep sequencing843 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).