Stem-loop sequence sha-mir-454

AccessionMI0019643 (change log)
DescriptionSarcophilus harrisii miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   uugaguuuccuacuguguaauuuaaaaauacauuuccuguugauacua     uc            ---         ----   --u     g 
5'                                                 ccaga  cuagaacccuau   cgauauugu    cuc   gcugu u
                                                   |||||  ||||||||||||   |||||||||    |||   |||||  
3'                                                 gguuu  gauuuugggaua   guuauaacg    gag   cgaua a
   ---------------------------------accggugacaagaaa     gu            uuc         ugau   ugu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL856812.1: 2872454-2872603 [+]
sense
ENSSHAT00000020932 ; SKA2-201; intron 1
ENSSHAT00000023795 ; sha-mir-454-201; exon 1
Database links

Mature sequence sha-miR-454

Accession MIMAT0022815
Sequence

101 - 

uagugcaauauugcuuauagggu

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).