Stem-loop sequence sha-mir-24-2

AccessionMI0019613 (change log)
DescriptionSarcophilus harrisii miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   cuuggccaccuuguucuucauccagucugucugcuucuaggucucacugggcucugc       g   a         aaca     --g u 
5'                                                          cuccugu ccu cugagcuga    caguu   c u
                                                            ||||||| ||| |||||||||    |||||   |  
3'                                                          gaggaca gga gacuugacu    gucaa   g u
   --------------------------------guccacagagguccucuuccggucu       a   c         --cg     aua g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DEVIL7_0) Overlapping transcripts
GL841415.1: 821238-821387 [+]
intergenic
Clustered miRNAs
< 10kb from sha-mir-24-2
sha-mir-23aGL841415.1: 820911-821060 [+]
sha-mir-24-2GL841415.1: 821238-821387 [+]
Database links

Mature sequence sha-miR-24

Accession MIMAT0022787
Sequence

101 - 

uggcucaguucagcaggaa

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).