Stem-loop sequence ola-mir-206

AccessionMI0019552 (change log)
DescriptionOryzias latipes miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

2 open access papers mention ola-mir-206
(7 sentences)

Stem-loop
   agu     ----       u  gg                cc     uuaau 
5'    uguuc    ccucuug ga  acaugcuuccuuauau  ccaua     a
      |||||    ||||||| ||  ||||||||||||||||  |||||     c
3'    acgag    ggagaac uu  ugugugaaggaaugua  gguau     a
   --u     uuca       u  gg                -a     ucacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
24: 13641157-13641256 [+]
intergenic
Clustered miRNAs
< 10kb from ola-mir-206
ola-mir-20624: 13641157-13641256 [+]
ola-mir-133-324: 13641851-13641950 [+]
Database links

Mature sequence ola-miR-206

Accession MIMAT0022659
Sequence

59 - 

uggaauguaaggaagugugug

 - 79

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).