Stem-loop sequence mmu-mir-5709

AccessionMI0019318 (change log)
Symbol MGI:Mir5709
DescriptionMus musculus miR-5709 stem-loop
Stem-loop
   aa    a      g           a             aagc 
5'   guug uaggcc gcaauacgcac cuuaagacuuuag    u
     |||| |||||| ||||||||||| |||||||||||||    c
3'   uaac auccgg cguuaugugug gaauucugaaauc    u
   cg    g      a           g             agac 
Get sequence
Deep sequencing
201 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 67026147-67026235 [-]
sense
ENSMUST00000037974 ; Ptprm-201; intron 7
Database links

Mature sequence mmu-miR-5709-5p

Accession MIMAT0022504
Sequence

18 - 

auacgcacacuuaagacuuuag

 - 39

Get sequence
Deep sequencing189 reads, 24 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-5709-3p

Accession MIMAT0027104
Sequence

53 - 

aaagucuuaaggguguguauug

 - 74

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21984899 "Neuronal activity regulates hippocampal miRNA expression" Eacker SM, Keuss MJ, Berezikov E, Dawson VL, Dawson TM PLoS One. 6:e25068(2011).