Dead miRNA entry

miRNA accession:
MI0019290
miRNA ID:
hsa-mir-5686
Comment:
The sequence annotated as mir-5686 is a low complexity repeat. There is no support for microRNA processing from available deep sequencing data.

Previous miRNA entry

Stem-loop sequence hsa-mir-5686

AccessionMI0019290 (change log)
Symbol HGNC:MIR5686~withdrawn
DescriptionHomo sapiens miR-5686 stem-loop
Stem-loop
      c    c    c    c    u    u    u    ug 
5' uau guau guau guau guau guau guac guau  u
   ||| |||| |||| |||| |||| |||| |||| ||||   
3' aug uaug uaug uaug uaug uaug uaug caug  a
      c    c    c    c    c    u    u    uu 
Get sequence
Deep sequencing
29 reads, 200 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-5686

Accession MIMAT0022477
Sequence

11 - 

guaucguaucguauuguauug

 - 31

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental;
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).