Stem-loop sequence gma-MIR5670a

AccessionMI0019264 (change log)
Previous IDsgma-MIR5670
DescriptionGlycine max miR5670 stem-loop
Gene family MIPF0001978; MIR5670
Literature search

1 open access papers mention gma-MIR5670a
(2 sentences)

Stem-loop
   u  g      c     a                            a     caaa      c  uua 
5'  ug aguuuc augaa caaauaugguaugauguaagggaaacau aaaac    guuagu ga   u
    || |||||| ||||| |||||||||||||||||||||||||||| |||||    |||||| ||   a
3'  ac ucaaag uacuu guuuauaccauacuacauuuccuuugua uuuug    caauca cu   g
   -  a      a     c                            g     acua      a  ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 6401527-6401662 [+]
intergenic
Database links

Mature sequence gma-miR5670a

Accession MIMAT0022452
Previous IDsgma-miR5670
Sequence

105 - 

caucauaccauauuugcuucau

 - 126

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).