Stem-loop sequence zma-MIR444a

Accession

MI0019128 (change log)

Description

Zea mays miR444a stem-loop

Gene family

MIPF0000402; MIR444

Literature search

9 open access papers mention zma-MIR444a
(16 sentences)

Stem-loop

         a                 c            -a      uu  u 
5' caagcu gaggcagcaacugcaua cuugcaagaaaa  aucggu  ug u
   |||||| ||||||||||||||||| ||||||||||||  ||||||  ||  
3' guucga cucuguuguugacgugu gaacguucuuuu  uagcca  gc g
         a                 u            ag      -u  a 

Deep sequencing

3676 reads, 1.05e+03 reads per million, 145 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR444 family. The primary unspliced transcript contains two exons split by an intron of 3997 nts [1].

Database links

• miRBase Tracker:MI0019128

Mature sequence zma-miR444a

• Accession: MIMAT0022261
• Sequence: 79 - ugcaguuguugucucaagcuu - 99
• Deep sequencing: 2800 reads, 17 experiments
• Evidence: by similarity; MI0006975
• Database links:
  • RNAcentral:URS000021A6BC_4577

References

1. PMID:21421552 "SplamiR--prediction of spliced miRNAs in plants" Thieme CJ, Gramzow L, Lobbes D, Theissen G Bioinformatics. 27:1215-1223(2011).