Stem-loop sequence sbi-MIR5568a

AccessionMI0019103 (change log)
Previous IDssbi-MIR5568
DescriptionSorghum bicolor miR5568 stem-loop
Gene family MIPF0001377; MIR5568
Literature search

2 open access papers mention sbi-MIR5568a
(3 sentences)

Stem-loop
   ucccaaca                               a   g  u c   gg 
5'         uuccaaauuguaagucguucuggcuuuucua gua au g ugu  c
           ||||||||||||||||||||||||||||||| ||| || | |||   
3'         aagguuuaacauucagcgagaccgagaagau uau ua c acg  u
   ----uaac                               g   g  u c   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 1926888-1926993 [-]
intergenic
Database links

Mature sequence sbi-miR5568a

Accession MIMAT0022248
Previous IDssbi-miR5568
Sequence

81 - 

cagagcgacuuacaauuugga

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).