Stem-loop sequence sbi-MIR5567

AccessionMI0019101 (change log)
DescriptionSorghum bicolor miR5567 stem-loop
Literature search

1 open access papers mention sbi-MIR5567
(3 sentences)

Stem-loop
   -----------------       c        a              c            a   --   --uaa          -------aug a                   g cuu 
5'                  uuaucua auuuaaug uucauguauguguc aaagauucgaug gau  gga     aaaaauuuug          g gaacuaaacagggccuaag c   g
                    ||||||| |||||||| |||||||||||||| |||||||||||| |||  |||     ||||||||||          | ||||||||||||||||||| |    
3'                  aguagau uaaauuau agguacguaugcag uuucuaagcuac cug  ccu     uuuuuaaaac          c cuugauuuguucuggauuu g   u
   cguuaauuaaaaauaaa       a        g              a            a   cu   uagac          guuuuaaaaa -                   - aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 52007869-52008082 [-]
intergenic
Database links

Mature sequence sbi-miR5567

Accession MIMAT0022246
Sequence

11 - 

uuaaugauucauguauguguccaa

 - 34

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).