Stem-loop sequence sbi-MIR5566

AccessionMI0019100 (change log)
DescriptionSorghum bicolor miR5566 stem-loop
Literature search

1 open access papers mention sbi-MIR5566
(2 sentences)

Stem-loop
   -----------       a   u                           aac   cc 
5'            gaguuuc gca caccucccuguuguucuccggguacac   cuc  c
              ||||||| ||| |||||||||||||||||||||||||||   |||   
3'            uuuaaag cgu guggaggggcgacaagagguuuaugug   gag  g
   cuagacucugc       c   c                           -ca   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 6668230-6668335 [+]
intergenic
Database links

Mature sequence sbi-miR5566

Accession MIMAT0022245
Sequence

6 - 

ucagcaucaccucccuguugu

 - 26

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).