Stem-loop sequence mtr-MIR5563

AccessionMI0019091 (change log)
DescriptionMedicago truncatula miR5563 stem-loop
Stem-loop
   -     uua        c                      ---ac     c 
5'  caauu   aaugauau aggcaacucgguccuucuguua     uuggc a
    |||||   |||||||| ||||||||||||||||||||||     ||||| a
3'  guuaa   uugcugua uccguugagucaggaaggcaau     aacug c
   g     uac        a                      gacca     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 42479761-42479861 [+]
intergenic
Database links

Mature sequence mtr-miR5563-5p

Accession MIMAT0022231
Previous IDsmtr-miR5563
Sequence

11 - 

ugauaucaggcaacucggucc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5563-3p

Accession MIMAT0022232
Previous IDsmtr-miR5563*
Sequence

72 - 

acugaguugccuaaugucguu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1