Stem-loop sequence mtr-MIR5562

AccessionMI0019090 (change log)
DescriptionMedicago truncatula miR5562 stem-loop
Stem-loop
   auaaaaca     gg        g    a       --     aaugggacgguggcaauaccgaaauggaaucguucaaagauugguccaaaacaacgagaaagcaugggaa 
5'         guugu  agucuuuu caug aguuucu  ugcug                                                                      g
           |||||  |||||||| |||| |||||||  |||||                                                                       
3'         caacg  ucggaaga gugu ucaaaga  acgau                                                                      a
   ucauacuc     --        g    a       aa     aacgaacuuagcgaauuauaacaacuuguuuaagguuaagaguuuagguaucaaaaacguugggagugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 11508769-11508992 [+]
intergenic
Database links

Mature sequence mtr-miR5562-5p

Accession MIMAT0022229
Previous IDsmtr-miR5562
Sequence

11 - 

uguggagucuuuugcaugaag

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5562-3p

Accession MIMAT0022230
Previous IDsmtr-miR5562*
Sequence

198 - 

auguggagaaggcugcaac

 - 216

Get sequence
Evidence experimental; Illumina [1]

References

1