Stem-loop sequence mtr-MIR5561

AccessionMI0019089 (change log)
DescriptionMedicago truncatula miR5561 stem-loop
Stem-loop
   -    a                 c       aa      u    g 
5'  ugga acuuucauuuggagaga auagaca  ugaaau aaau a
    |||| ||||||||||||||||| |||||||  |||||| ||||  
3'  accu ugaagguaaaucucucu uaucugu  acuuua uuua u
   u    g                 c       -a      -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 33922012-33922100 [-]
intergenic
Database links

Mature sequence mtr-miR5561-5p

Accession MIMAT0022227
Previous IDsmtr-miR5561
Sequence

11 - 

cauuuggagagacauagacaa

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence mtr-miR5561-3p

Accession MIMAT0022228
Previous IDsmtr-miR5561*
Sequence

60 - 

gucuaucucucucuaaaugga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).