Stem-loop sequence mtr-MIR5554c

AccessionMI0019088 (change log)
DescriptionMedicago truncatula miR5554c stem-loop
Gene family MIPF0000815; MIR2592
Stem-loop
   - a    g     u      ug   a                   -     c 
5'  c acau ugaug gcaucu  aac augguauucaagugucaag gaaug a
    | |||| ||||| ||||||  ||| ||||||||||||||||||| ||||| c
3'  g ugua gcuac cguaga  uug uaccauaaguucacaguuu cuuac c
   g c    a     u      cg   c                   u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 22600323-22600427 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5554c
mtr-MIR2592bechr7: 22606713-22607142 [+]
mtr-MIR5554cchr7: 22600323-22600427 [-]
Database links

Mature sequence mtr-miR5554c-5p

Accession MIMAT0022225
Previous IDsmtr-miR5554c
Sequence

11 - 

ugugcaucuugaacaaugguau

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5554c-3p

Accession MIMAT0022226
Previous IDsmtr-miR5554c*
Sequence

75 - 

accaucguugcagaugcucauc

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1