Stem-loop sequence mtr-MIR5560

AccessionMI0019087 (change log)
DescriptionMedicago truncatula miR5560 stem-loop
Stem-loop
   a     c   c    -      c c              -    c      a   g 
5'  gucgg aau cucu cauuca u agccgguacaucau uggu guugga uuu a
    ||||| ||| |||| |||||| | |||||||||||||| |||| |||||| |||  
3'  caguc uua gagg guaagu a ucggccguguagua auca caaccu gga u
   -     u   a    c      a c              c    a      a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 4372015-4372125 [+]
intergenic
Database links

Mature sequence mtr-miR5560-5p

Accession MIMAT0022223
Previous IDsmtr-miR5560*
Sequence

14 - 

cucauucacucagccgguaca

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5560-3p

Accession MIMAT0022224
Previous IDsmtr-miR5560
Sequence

80 - 

ugccggcucaaugaaugcggag

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1