Stem-loop sequence mtr-MIR5557

AccessionMI0019083 (change log)
DescriptionMedicago truncatula miR5557 stem-loop
Stem-loop
   c      c  c                            aaaguaacucuuuacuuuguugugcccauucagugcauuuagccaucaaccucuccuucugaacaucacauuuguucacuacugauuucaaaucaucucuuuguuucacaagaucauc 
5'  aggaca uu ucaacaaguacuaaggaagcacaaucag                                                                                                                      a
    |||||| || ||||||||||||||||||||||||||||                                                                                                                       
3'  uucugu aa aguuguucaugauuccuucguguugguu                                                                                                                      a
   -      c  u                            gaagaaauaagcuuuugacuauaauacuuguucgaauccucacguuucucaugugauuggguuuaacugucacuuagaaguugauguuuacgagucuauguguuugagagaaauguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 5907137-5907451 [+]
intergenic
Database links

Mature sequence mtr-miR5557-5p

Accession MIMAT0022215
Previous IDsmtr-miR5557*
Sequence

14 - 

aacaaguacuaaggaagcaca

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5557-3p

Accession MIMAT0022216
Previous IDsmtr-miR5557
Sequence

285 - 

ugcuuccuuaguacuuguuga

 - 305

Get sequence
Evidence experimental; Illumina [1]

References

1