Stem-loop sequence mtr-MIR5554b

AccessionMI0019079 (change log)
DescriptionMedicago truncatula miR5554b stem-loop
Gene family MIPF0000815; MIR2592
Stem-loop
   - a    g     u      ug   a                   -     c 
5'  c gcau cgaug gcaucu  aac augguauucaagugucaag gaaug a
    | |||| ||||| ||||||  ||| ||||||||||||||||||| ||||| c
3'  g ugua gcuac cguaga  uug uaccauaaguucacaguuu cuuac c
   g c    g     u      cg   c                   u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 29332267-29332371 [+]
intergenic
Database links

Mature sequence mtr-miR5554b-5p

Accession MIMAT0022207
Previous IDsmtr-miR5554b
Sequence

11 - 

ugugcaucuugaacaaugguau

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5554b-3p

Accession MIMAT0022208
Previous IDsmtr-miR5554b*
Sequence

75 - 

accaucguugcagaugcucauc

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1