Stem-loop sequence mtr-MIR5555

AccessionMI0019076 (change log)
DescriptionMedicago truncatula miR5555 stem-loop
Stem-loop
   uac              a                   ---   -   u 
5'    auguaucuaagagu uaauaugacuuugauuaug   aca cac u
      |||||||||||||| |||||||||||||||||||   ||| ||| u
3'    uacauagauucuca auuaugcugaagcuaauac   ugu gug g
   aac              c                   cgu   a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 13399421-13399515 [-]
intergenic
Database links

Mature sequence mtr-miR5555-5p

Accession MIMAT0022201
Previous IDsmtr-miR5555
Sequence

11 - 

uaagaguauaauaugacuuug

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5555-3p

Accession MIMAT0022202
Previous IDsmtr-miR5555*
Sequence

67 - 

aagucguauuacacucuuaga

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1