Stem-loop sequence osa-MIR5530

AccessionMI0019050 (change log)
DescriptionOryza sativa miR5530 stem-loop
Literature search

1 open access papers mention osa-MIR5530
(1 sentences)

Stem-loop
   ------------------acuguug  g  u            cc   -   uau  ga          c 
5'                          gc ag ggugucguauua  ugc ccu   ag  caugaugcau a
                            || || ||||||||||||  ||| |||   ||  |||||||||| u
3'                          ug uc ccauaguauagu  acg ggg   uc  guauuacgua g
   ggacgaugauuaauaaucaaaugua  a  u            --   a   ---  -g          c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 21782328-21782445 [+]
intergenic
Database links

Mature sequence osa-miR5530

Accession MIMAT0022165
Sequence

11 - 

aguggugucguauuaccugcc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1