Stem-loop sequence osa-MIR5511

AccessionMI0019029 (change log)
DescriptionOryza sativa miR5511 stem-loop
Literature search

1 open access papers mention osa-MIR5511
(1 sentences)

Stem-loop
   uug ug aag      -  gu u         uggaaauaacuuccuagcuggcuggccuaaga 
5'    g  g   aaggcc aa  g uugggaugu                                a
      |  |   |||||| ||  | |||||||||                                a
3'    c  c   uuccgg uu  u gacccuaua                                u
   uua gu --g      c  ug c         cguaccaaacuuugccgagaaacagauacuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 14653011-14653138 [-]
intergenic
Database links

Mature sequence osa-miR5511

Accession MIMAT0022144
Sequence

98 - 

cauaucccagcuguuucggcc

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1