Stem-loop sequence osa-MIR5495

AccessionMI0019013 (change log)
DescriptionOryza sativa miR5495 stem-loop
Literature search

1 open access papers mention osa-MIR5495
(2 sentences)

Stem-loop
   a   aaccc        c        -  u  --g  u   -       auggcaaacaaacguaccgcguauugucucuuacagccuuauagcacauucugcacucuugucucaugggcugugcacauuguu 
5'  cau     gagagguc ggaucgaa cg ag   aa agu caagaaa                                                                                    u
    |||     |||||||| |||||||| || ||   || ||| |||||||                                                                                     
3'  gua     cuuuccgg ccuaguuu gu uc   uu uca guucuuu                                                                                    u
   g   aaguu        u        c  u  aga  c   a       aauuaaguguaucgugggacccucuucuucuaucacuuuaccgaacgcguccgguugcuccaguguuacuagagguacccauag 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 20298332-20298595 [+]
intergenic
Database links

Mature sequence osa-miR5495

Accession MIMAT0022128
Sequence

11 - 

agagguccggaucgaacguag

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1