![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR166j |
|||||
Accession | MI0018661 (change log) | ||||
Description | Glycine max miR166j stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
36 open access papers mention gma-MIR166j | ||||
Stem-loop |
g uu cu uaacuaugcau uuuu - ----aa u uu u 5' gguu augggaaug guuugg cgagg ggucuuaa guuca ucuuugaagcuuu uuua ggg ucga c |||| ||||||||| |||||| ||||| |||||||| ||||| ||||||||||||| |||| ||| |||| u 3' ccaa ugcccuuac cggacc gcucu ucggaguu uaggu ggaaauuucgaaa aagu ccc aguu c a uu ag ----------u ---u u gaaaca u -u u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR166j-5p |
|
Accession | MIMAT0021647 |
Sequence |
9 - ggaauguuguuuggcucgagg - 29 |
Evidence | experimental; Illumina [1] |
Mature sequence gma-miR166j-3p |
|
Accession | MIMAT0021648 |
Sequence |
142 - ucggaccaggcuucauucccg - 162 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|