Stem-loop sequence sly-MIR5304

AccessionMI0018481 (change log)
DescriptionSolanum lycopersicum miR5304 stem-loop
Gene family MIPF0001713; MIR5304
Literature search

2 open access papers mention sly-MIR5304
(2 sentences)

Stem-loop
         uuag          ca  ug u          ua          c cac           cacg 
5' ucuaau    auccauggug  gu  c cauucaaugc  cauacucauc c   aacuuucaucu    u
   ||||||    ||||||||||  ||  | ||||||||||  |||||||||| |   |||||||||||     
3' agauug    uggguaccau  cg  g guagguuacg  guaugaguag g   uugaaaguaga    u
         -uag          ac  gu u          ug          a aua           aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 97204436-97204576 [+]
intergenic
Database links

Mature sequence sly-miR5304

Accession MIMAT0020768
Sequence

32 - 

ucaaugcuacauacucauccc

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21443685 "Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns" Mohorianu I, Schwach F, Jing R, Lopez-Gomollon S, Moxon S, Szittya G, Sorefan K, Moulton V, Dalmay T Plant J. 67:232-246(2011).