Stem-loop sequence mtr-MIR2629h

AccessionMI0018413 (change log)
DescriptionMedicago truncatula miR2629h stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
   --a    gua u    aaga  c             gca      u  g 
5'    uuuu   g gcag    uc ucggcaguuaacu   gccgga uu a
      ||||   | ||||    || |||||||||||||   |||||| || g
3'    aaag   c uguc    ag agccgucaauuga   cggcuu aa a
   cca    aag -    -aaa  a             ---      u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 35459621-35459714 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2629h
mtr-MIR2592tchr3: 35460547-35460778 [+]
mtr-MIR2592gchr3: 35460535-35460792 [-]
mtr-MIR2629hchr3: 35459621-35459714 [-]
Database links

Mature sequence mtr-miR2629h

Accession MIMAT0021310
Sequence

11 - 

gcagaagauccucggcaguuaacu

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).