![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR156j |
|||||
Accession | MI0018375 (change log) | ||||
Description | Medicago truncatula miR156j stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
10 open access papers mention mtr-MIR156j | ||||
Stem-loop |
a -a a gg a gucuuua ua 5' cau gaaauug cagaagag ugagcaca aaaaa guaua a ||| ||||||| |||||||| |||||||| ||||| ||||| u 3' gua uuuuaac gucuucuc acucgugu uuuuu cauau g - ac a au g --auuac uu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mtr-miR156j |
|
Accession | MIMAT0021272 |
Sequence |
11 - ugacagaagagggugagcac - 30 |
Evidence | experimental; Illumina [1-3] |
References |
|
1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
2 |
PMID:21762498
"Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing"
BMC Genomics. 12:367(2011).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|