Stem-loop sequence mtr-MIR2643b

AccessionMI0018354 (change log)
DescriptionMedicago truncatula miR2643b stem-loop
Stem-loop
   gucc    au        c    u      uua     a   cau 
5'     uuga  ucucuaau ucug ucccaa   cacuu auc   g
       ||||  |||||||| |||| ||||||   ||||| |||    
3'     aacu  agagauua agac aggguu   gugaa uag   a
   ucau    au        a    u      uga     c   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 41256981-41257072 [-]
intergenic
Database links

Mature sequence mtr-miR2643b-5p

Accession MIMAT0021249
Previous IDsmtr-miR2643b*
Sequence

13 - 

ucuaaucucuguucccaauua

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR2643b-3p

Accession MIMAT0021250
Previous IDsmtr-miR2643b
Sequence

62 - 

uuugggaucagaaauuagaga

 - 82

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2