Stem-loop sequence mtr-MIR5217

AccessionMI0018281 (change log)
DescriptionMedicago truncatula miR5217 stem-loop
Stem-loop
      uc     a   -  -u     a   u      gauuguacuuguugcuguucaggugauaggcacguuuagguc 
5' agg  uuaga ggu ca  uuuga cgg cggauu                                          c
   |||  ||||| ||| ||  ||||| ||| ||||||                                           
3' ucc  aaucu cca gu  gaacu gcc gcuuga                                          u
      -c     -   u  uc     a   u      uagggaaguauuugaucaguugaaucauugaucaaaugaagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 10824001-10824152 [-]
intergenic
Database links

Mature sequence mtr-miR5217

Accession MIMAT0021175
Sequence

11 - 

aggucauuuugaacggucggau

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).