Stem-loop sequence bdi-MIR5177

AccessionMI0018148 (change log)
DescriptionBrachypodium distachyon miR5177 stem-loop
Stem-loop
   gucc     ug g  ac    g ua                 c  ---g    a g a     c       u    uc  u        aa        g    a      acgaugccguguauaugcuguaucacuaccauaacacuggcaugacaucaaacagaucagucucuucacuggaugcgcaugguucggguuaaaacca 
5'     acuuu  a cc  gaac u  aaaucgucugaguugca cc    aacu u a aacug cuguuuu caac  ca gugguuuu  acaagugg uuug cugaca                                                                                                 u
       |||||  | ||  |||| |  ||||||||||||||||| ||    |||| | | ||||| ||||||| ||||  || ||||||||  |||||||| |||| ||||||                                                                                                  
3'     ugaaa  u gg  cuug g  uuuggcagacucaacgu gg    uuga a u uugac gacaaaa guug  gu uaccaaag  uguuuacc aagc gacugu                                                                                                 g
   -guu     gu g  -a    g gg                 u  agaa    c g c     a       u    ga  c        --        a    a      aucaccaaacgguguagagaccggguggcaguuuguauggucuuuacucucuccugucucccccguuacuccuuguccuacucaucacucucaaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 9879796-9880206 [+]
intergenic
Database links

Mature sequence bdi-miR5177

Accession MIMAT0020724
Sequence

334 - 

ugagguuguaaaacagacagu

 - 354

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).