Dead miRNA entry

miRNA accession:
MI0018099
miRNA ID:
bdi-MIR397b
Forward to:
MI0011565
Comment:
Two previously annotated MIR397 entries map to the same locus in the v1.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bdi-MIR397b

AccessionMI0018099 (change log)
DescriptionBrachypodium distachyon miR397b stem-loop
Stem-loop
   --     gag    ua --a     -c    a   a      a           a     ag     ag c       g       - --     -g     c           a      c   c    au     ggc cg    --a    u 
5'   gcgaa   gaau  g   agagg  gcaa ggc ucauug gugcagcguug ugaac  gggcc  g gaccggc gccgguc c  gguuc  guuca cggcgcugcac caguga gcc uugc  ucucu   c  auuc   uuug g
     |||||   ||||  |   |||||  |||| ||| |||||| ||||||||||| |||||  |||||  | ||||||| ||||||| |  |||||  ||||| ||||||||||| |||||| ||| ||||  |||||   |  ||||   ||||  
3'   uguuu   cuua  c   ucucu  cguu ccg agugac cacgucgcggc acuug  cuugg  c cuggccg cggccag g  ccggg  caagu guugcgacgug guuacu cgg aacg  ggaga   g  uaag   aagc u
   ug     --a    gc cgg     ua    c   c      a           c     -g     -- -       g       c ga     ga     a           a      a   a    -c     --a au    gag    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 3177780-3177881 [-]
intergenic
Database links

Mature sequence bdi-miR397b

Accession MIMAT0020674
Sequence

180 - 

cauugagugcagcguugauga

 - 200

Get sequence
Evidence experimental;

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).