Stem-loop sequence bdi-MIR164b

AccessionMI0018094 (change log)
DescriptionBrachypodium distachyon miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

3 open access papers mention bdi-MIR164b
(17 sentences)

Stem-loop
   aaga         uc  c    --       c u     a  c                u  aacuagagcuuagcuagugucaauucuuccaucucuugugccug 
5'     gaggagagc  ag gaga  aggaccg g uggag ag agggcacgugcaugca gc                                            g
       |||||||||  || ||||  ||||||| | ||||| || |||||||||||||||| ||                                            c
3'     uuucuuucg  uc cuuu  uucuggc c accuc uc ucuuguguacguacgu cg                                            c
   --ca         -c  u    ac       a u     c  u                -  uagguuauccacgguuuaauucgagccauauauucuagcuaggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 14544140-14544348 [+]
intergenic
Database links

Mature sequence bdi-miR164b

Accession MIMAT0020669
Sequence

33 - 

uggagaagcagggcacgugca

 - 53

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).