Stem-loop sequence bdi-MIR167b

AccessionMI0018091 (change log)
DescriptionBrachypodium distachyon miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention bdi-MIR167b
(7 sentences)

Stem-loop
   -----    uacuuacuuac       -----     c      a      --             uca        aag       cacacauacacgugugguu 
5'      gugc           ugcccga     gggaa gaguga gcugcc  agcaugaucuagc   gcgugauc   caagauu                   u
        ||||           |||||||     ||||| |||||| ||||||  |||||||||||||   ||||||||   |||||||                    
3'      cacg           acggguu     cccuu uucacu cgacgg  ucguacuggaucg   cguacugg   guucuag                   u
   gucga    ----------u       ugccg     c      c      cg             uuc        --a       uuagcucgauaucgaguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 3770002-3770191 [+]
intergenic
Database links

Mature sequence bdi-miR167b

Accession MIMAT0020666
Sequence

32 - 

ugaagcugccagcaugaucua

 - 52

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).